pyk [2019-06-28 11:44:57]

pyruvate kinase, glycolytic enzyme

locus: BSU29180

pI: 4.88

mw: 62.00 kDa

protein length: 585 aa

gene length: 1758 bp

function: catabolic enzyme in glycolysis

product: pyruvate kinase

essential: no

ec: 2.7.1.40

synonyms: pykA

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]

Gene

Coordinates: 2,984,788 → 2,986,545

Phenotypes of a mutant

• unable to grow with non-[protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] carbohydrates (such as glucitol or glycerol) as single carbon source
• suppression of ''[gene|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]

The protein

Catalyzed reaction/ biological activity

• ADP + phosphoenolpyruvate -→ ATP + pyruvate
• The reaction is irreversible under physiological conditions

Protein family

• C-terminal part: [SW|PEP-utilizing enzyme family] (according to UniProt)

Modification

• phosphorylation on Ser36 [Pubmed|17218307], [Pubmed|16493705], phosphorylation on Ser536 or Ser546 [Pubmed|17726680], please note that the Ser is not on position 536 but rather at 538

[SW|Cofactors]

• Mg2+, K+

Effectors of protein activity

• Activated by PEP (Hill Coefficient 1,8) [Pubmed|4623707] [Pubmed|3711058]
• Allosterically activated by AMP [Pubmed|3711058]
• Activation by r5p and ADP [Pubmed|3711058]
• Inhibition by ADP and f16bp in high concentrations; and ATP [Pubmed|3711058]

Structure

• [PDB|2E28] (Geobacillus stearothermophilus) [pubmed|18511452]

[SW|Localization]

• cytoplasm [Pubmed|16479537]

Additional information

• The enzyme is a tetramer with four active sites [Pubmed|3711058]
• belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]

Expression and Regulation

Operons

• genes: [gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]-[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]-[gene|1C6D935B36416327FE63CABC53440441E8563D7E|ytzA]
  description: [Pubmed|11489127]

  regulation

  • twofold induced by glucose [Pubmed|11489127]

Biological materials

Mutant

• GP589 (''pyk''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
• GP600 (''pyk''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
• GP1745: BSB1 ''pyk::aphA3'', available in [SW|Jörg Stülke]' lab
• BKE29180 (Δ[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA
• BKK29180 (Δ[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA

Expression vectors

• expression in ''E. coli'', N-terminal His-tag: pGP1100 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
• expression in ''B. subtilis'', native protein: pGP1411 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
• expression in ''B. subtilis'', N-terminal Strep-tag: pGP1409 (in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
• expression in ''B. subtilis'', C-terminal Strep-tag: pGP1410 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab

lacZ fusion

• see ''[gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]

labs

• [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

References

• 17726680,16493705,11489127,17505547,10966427,17218307,3711058,4623707,21821766,22846916,23420519,24158146,24571712,15378759,24825009,28516784,18511452